- Journal List
- HHS Author Manuscripts
- PMC11323259
As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsem*nt of, or agreement with, the contents by NLM or the National Institutes of Health.
Learn more: PMC Disclaimer | PMC Copyright Notice
Methods Mol Biol. Author manuscript; available in PMC 2024 Aug 14.
Published in final edited form as:
Methods Mol Biol. 2018; 1680: 29–40.
PMCID: PMC11323259
NIHMSID: NIHMS2013240
PMID: 29030839
Hong-Duc Phan,1,2 Junan Li,4 Ming Poi,4,* and Kotaro Nakanishi1,2,3,*
Author information Copyright and License information PMC Disclaimer
The publisher's final edited version of this article is available at Methods Mol Biol
Abstract
MicroRNAs (miRNAs) are small non-coding RNAs that trigger post-transcriptional gene silencing. These RNAs need to be associated with the Argonaute proteins to be functional. This assembly begins with loading of a miRNA duplex, followed by the ejection of one of the strands (passenger). The remaining strand (guide) together with the Argonaute protein forms a ribonucleoprotein effector complex (the RNA-induced silencing complex, RISC). Mutation on the Argonaute protein, if affecting either step of the RISC assembly, impacts the function of miRNAs. Therefore, any observation of decreased miRNA level of mutants will provide insights into the role of those amino acid residues in the mechanical function of the Argonaute protein. In this chapter, we introduce a method to relatively quantify a specific miRNA co-immunoprecipitated with wild type and mutant Argonaute proteins from HEK293T cells, using Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR). Spiking a synthetic exogenous miRNA as an internal control with RNA extraction prior to cDNA synthesis will normalize the Ct values obtained from the qRT-PCR assays and enable us to quantify the relative level of Argonaute-bound miRNA.
Keywords: qRT-PCR, miRNA, Argonaute, immunoprecipitation, SYBR Green
1. Introduction
miRNAs are single-stranded RNAs of about 22 nucleotides (nt) that are generated from the endogenous hairpin-shaped transcript [1,2]. In human, miRNA duplexes are loaded into four Argonaute paralogs (Ago1–4) [1,3]. After passenger-strand ejection, the remaining guide and the Argonaute protein form the RNA-induced silencing complex (RISC) [4,5]. This ribonucleoprotein complex also provides a scaffold for the components essential for translational repression and deadenylation [3,4,6]. To understand the versatile functions of Argonaute proteins, previous studies compared the physiological activities between wild type (WT) and the mutant proteins. For example, FLAG-tagged human Argonaute (FLAG-Ago) proteins were expressed in HEK293T cells and purified by immunoprecipitation with anti-FLAG antibody from the cell lysate [7]. The miRNA-binding activities of Argonaute mutants were evaluated using Northern blot using a probe for a particular miRNA [7–9]. This method has been routinely used to identify residues on Argonaute proteins playing important role(s) during loading of miRNA and/or passenger-strand ejection [10–12]. Despite its high specificity, Northern blot has some disadvantages, such as being time-consuming, low throughput, and low sensitivity for small RNA detection [13–15].
Recently, Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) is becoming more popular as an alternative method to Northern blot. However, there are two major obstacles preventing the use of qRT-PCR in quantifying miRNA co-immunoprecipitated with FLAG-Ago. First is the primer design for qRT-PCR. Historically, qRT-PCR has been developed for detection of mRNA; therefore, the techniques and knowledge based on mRNA detection may not be applicable for miRNA, primarily due to the much shorter length. The use of stem-loop qRT-PCR may partially solve the problems, but this method requires the use of stem-loop reverse transcription primers (also known as TaqMan® MicroRNA assay), which has been licensed to Applied Biosystems™ [16,17]. Another obstacle is that a reference gene such as a housekeeping gene needs to be used as an internal control to normalize variances between samples [18]. Previous studies often used fortuitously bound RNA such as GAPDH as a reference gene for the normalization of the Ct value when employing qRT-PCR to detect a specific mRNA co-immunoprecipitated with Argonaute proteins [19–21]. This approach may introduce considerable variance in the quantification of miRNA co-immunoprecipitated with Argonaute mutants when the mutation affects the binding of such RNAs.
To address the issue of primer design, we employed SYBR Green-based qRT-PCR with polyT adaptor primers (Fig. 1) [22]. This approach is cost-effective, especially in the case of systematic quantification of different target miRNAs co-immunoprecipitated with large number of Argonaute protein mutants. In this method, miRNAs will be first polyadenylated by poly(A) polymerase (Fig. 1, step 1), prior to the complementary DNA (cDNA) synthesis by reverse transcription using an oligo-dT adaptor primer composed of a polyT primer and a universal tag on its 5’ side (Fig. 1, step 2). Then, an equal amount of an exogenous miRNA, cel-miR-39, was spiked as the internal control into the immunoprecipitated Argonaute proteins whose amount was adjusted based on western blot analysis before RNA extraction (Fig. 2) [23]. The difference in threshold cycles for the miRNA of interest and the spiked cel-miR-39 enables us to normalize RNA extraction from the different immunoprecipitated proteins.
Figure 1.
Schematic representation of polyT adaptor qRT-PCR method.
Step 1: poly(A) tail is added to miRNA by poly(A) polymerase. Step 2: cDNA is synthesized by reverse transcriptase using oligo-dT adaptor primer. Step 3: cDNA is amplified by SYBR Green-based qPCR with miRNA-specific and universal PCR primers.
Figure 2.
Workflow of SYBR Green-based qPCR of miRNAs using an exogenous miRNA as an internal control.
2. Materials
Dynabeads Protein G (Thermo Fisher Scientific).
Magnetic rack, DynaMag-2 Magnet (Thermo Fisher Scientific) or equivalent.
Ultrasonic processor.
Bench top tube rotator.
Vortex mixer.
Anti-FLAG M2 antibody, F1804 (Sigma). The antibody is diluted 1000 times with the blotting buffer containing 5% of skim milk and 1% of sodium azide as working solution for Western blot.
Lysis buffer: 30 mM HEPES-KOH (pH 7.4), 100 mM KOAc, 2 mM Mg(OAc)2, 10 μg/μl Aprotinin*, 10 μM Leupeptin*, 1 μM Pepstatin*, and 1 mM phenylmethylsulfonyl fluoride (PMSF)*(*: freshly prepared).
Wash buffer: 30 mM HEPES-KOH (pH 7.4), 100 mM KOAc, 2 mM Mg(OAc)2, 800 mM NaCl, and 1% Triton X-100.
See AlsoGDP up by 0.3% and employment up by 0.2% in the euro area19.4 Comparing GDP among Countries – Principles of EconomicsGiven a macroeconometric model y = Yt-1 + m, where y is real GDP, Y is potential output, m is the growth rate of monetary supply, and ε is an i.i.d random noise which makes steady-state E(y) = y and minimizes steady-state Var(y). Given y = 100, Y = 60, mThe table below shows aggregate values and real GDP is equal to Y^(**). able[[Potential GDP,14000 The table below shows aggregate values and real GDP is equal to Y* Potential GDP Government purchases14 000 2200300 11500 Investment Consumption Net tax revCel-miR-39 (GE Dharmacon): 5’ UCACCGGGUGUAAAUCAGCUUG 3’
Proteinase K reaction buffer: 200 mM Tris-HCl (pH 7.5), 25 mM EDTA (pH 8.0), 300 mM NaCl, and 2% sodium dodecyl sulfate (SDS) (w/v).
Proteinase K, 20 mg/ml.
TRIzol LS reagent (Thermo Fisher Scientific).
Direct-zol RNA kits (Zymo Research).
TransIT-X2 Dynamic Delivery System (Mirus Bio).
qScript microRNA cDNA Synthesis Kit (Quanta Bio).
PerfeCTa SYBR Green SuperMix (Quanta Bio)
Universal PCR primer (Quanta Bio).
Forward primer to detect miR-19b and cel-miR-39 (ordered from Quanta Bio).
cel-miR-39 GCAGCTGATTTCGTCTTGGTAA miR-19b GTGCAAATCCATGCAAAACTG Open in a separate window
2X SDS-loading dye: 125 mM Tris-HCl (pH 6.8), 4% Sodium dodecyl sulfate (SDS), 20% Glycerol, 0.04% Bromophenol blue, and 100 mM beta-mercaptoethanol* (*freshly prepared).
Opti-MEM reduced serum media (Gibco).
Nitrocellulose blotting membrane (GE healthcare).
Electrophoresis chamber (Bio-RAD)
Blotting buffer: 20 mM Tris-base, 150 mM NaCl, and 0.001% Tween 20.
Blocking buffer: 20 mM Tris-base, 150 mM NaCl, 0.001% Tween with 10% (w/v) skim milk.
Novex NuPAGE SDS-PAGE gel (Invitrogen).
Image StudioLite (Li-cor).
Odyssey® Imaging Systems (Li-cor).
IRDye® 800CW Goat anti-Mouse IgG (H + L), 0.1 mg (fluorescent-label secondary antibody, Li-cor). The antibody is diluted at 1:16000 with dilution buffer containing 50% PBS (pH7.4), 50% Odyssey buffer and 0.01% Tween as working solution for Western blot.
pCAGEN-FLAG-Ago2 WT[24]
. pCAGEN-FLAG-Ago2 Y529E is made using following forward and reverse site-directed mutagenesis primers :
Forward : 5’- CGGCAAGACGCCCGTGGAAGCCGAG-3’, Reverse : 5’ ACGCGCTTGACCTCGGCTTCCACGGGC-3’
The gene of MBP is amplified from pMAL vector (Novagen) with the following forward and reverse primers and processed with EcoRI and NotI. Then, the fragment is cloned into pCAGEN vector using the same restriction enzyme sites. Forward: 5’-GAGTGAATTCATGAAAATCGAAGAAGGTAAACTGGTAAT-3’, Reverse: 5’-CACTGCGGCCGCTCAATTAGTCTGCGCGGCTGC-3’
(EcoRI and NotI sites are underscored.)
3. Methods
We quantified miR-19b, one of the most abundant miRNAs in HEK293T cells [25] and compare the miRNA-binding activities between the FLAG-Ago2 WT and Y529E mutant. The latter was previously reported as a mutant deficient in miRNA binding by Northern blot analysis [12]. Non-tagged MBP was used as a negative control.
3.1. Overexpression of MBP, FLAG-Ago2 WT and FLAG-Ago2Y529E proteins in HEK293T cells
Transfect the mixture of 10 μg plasmids, 45 μl of TransIT-X2 reagent, and 1.5 ml OMEM into the 10cm plates of 80% confluent HEK293T cells, according to the manufacturer manual’s instruction. Cultivate the cells for 48–50 hours.
After rinsing the cells once with 10 ml cold PBS, detach the cell off the plates by vigorously pipetting the cells with PBS. Harvest the cell by centrifugation at 1,000 × g for 10 min at 4°C. Measure the weight of the cell pellet (x mg). Hereafter, handle the samples at 4°C through the whole procedure.3. Resuspend the cell pellet with 5 times of the pellet weight (5× μl) of lysis buffer in a 1.7 ml microcentrifuge tube. Place the tube in an ice bucket and sonicate at 30 % amplitude using Microtip for 20 seconds in 4 seconds burst with at least 60-second intervals. Incubate on ice for 5 minutes, and centrifuge at 17,000 × g for 20 min at 4°C. Collect the supernatant and aliquot into 100 μl fraction in microcentrifuge tubes. Then, flash-freeze the lysate in liquid nitrogen and store them at −80 0C.
3.2. FLAG-Ago immunoprecipitation using Anti-FLAG M2 antibody
For each FLAG-Ago sample, aliquot 60 μl of Dynabeads Protein G into a 1.7 ml microcentrifuge tube and resuspend with 1 ml of Lysis buffer. Set the tubes on the magnetic rack and remove the solution. Repeat this wash process three times.
Resuspend the beads in 60 μl of Lysis buffer, followed by mixing with 2 μl of 1 mg/ml anti-FLAG M2 antibody. Shake the tube on the vortex mixer at room temperature for one hour.
Resuspend the antibody-conjugated beads with 1 ml of Lysis buffer. Set the tube on the magnetic rack and remove the solution. After repeating this wash process three times, discard the supernatant.
Quickly thaw the frozen 100 μl-cell lysate aliquot from step 3 of the section 3.1, and incubate with the antibody-conjugated beads at 4°C for 2 hours on a benchtop tube rotator.
Add 1 ml of Wash buffer to the beads and resuspend the mixture. Set the tubes on the magnetic rack and discard the supernatant. Repeat this wash process five times.
3.3. Semi-quantification of immunoprecipitated protein by Western blot
We followed the standard western blot protocol [26] with some modifications.
Take 3 μl of the beads from step 5 in the section 3.2 and mix with 2 μl of 2× SDS-loading dye and 7 μl of water to the final volume of 12 μl. Heat the sample at 90°C for 5 minutes.
After spinning down the sample, load the supernatant on the SDS-PAGE gel. Run the gel at a constant voltage of 180 V until the bromophenol blue reaches to the bottom.
Transfer the sample from the gel to the nitrocellulose blotting membrane in the electrophoresis chamber at a constant voltage of 80 V for 1.5 hours at 4°C.
Block the membrane with 20 ml of blocking buffer for 1 hour.
Incubate the membrane for 2 hours at room temperature with 10 ml of anti-FLAG M2 antibody working solution.
After discarding the antibody, add 20 ml of blotting buffer to the membrane and incubate them for 10 minutes. Repeat this wash process three times.
Incubate the membrane for 1 hour with 40 ml of secondary antibody working solution.
After discarding the second antibody, add 20 ml of Blotting buffer to the membrane, and incubate them for 10 minutes. Repeat this wash process three times.
Fluorescence from the fluorescent-labeled secondary antibody is detected in the 800 channel of Odyssey Imaging System.
Quantify the fluorescent intensity from the immunoprecipitated Ago protein using Image StudioLite software (Figure 3).
Open in a separate windowFigure 3.
Expression and immunoprecipitation of FLAG-Ago2 WT and Y529E.
a. Expression levels of FLAG-Ago2 WT and Y529E were detected by anti-FLAG antibody. Anti-tubulin antibody was used to detect tubulin as an internal control. Non-tagged MBP was used as a negative control. Western blot analysis was triplicated. b. Immunoprecipitated FLAG-Ago2 WT and Y529E were detected by anti-FLAG antibody.
3.4. Extraction of RNA from immunoprecipitated FLAG-Ago
Adjust the amount of beads based on the intensities of immunoprecipitated Ago of the Western blot data from step 10 in the section 3.3.
Add 250 μl of proteinase K buffer and 10 μl of 20 mg/ml proteinase K to the protein immunoprecipitated beads. Incubate the mixture at 50 ºC for 30 minutes.
Spike 1 μl of 10 nM of cel-miR-39 into each sample as an internal control (Note 3).
Add 200 μl of TRIzol LS reagent to each sample and vortex the mixture for 30 seconds, followed by incubation at room temperature for 5 minutes. Centrifuge at 17,000 × g for 10 minutes to remove the beads and debris. Transfer the supernatant to a new tube.
Mix the supernatant with an equal volume of 100% ethanol and transfer the mixture to the spin column of Direct-zol RNA kits. Hereafter, follow the instruction of the kit to extract the total RNA.
Elute the total RNA from the spin column with 20 μl of RNase-free water. The RNA eluents can be stored at −80°C until they are used for cDNA synthesis step.
3.5. cDNA preparation
Take 7 μl of RNA for the poly(A) tailing reaction, following the qScript microRNA cDNA Synthesis Kit’s instructions: incubate the reaction at 37°C for 1 hour, followed by another incubation at 70°C for 5 minutes.
Reagents Volume 5× Poly(A) tailing buffer 2 μl RNA 7 μl Poly(A) polymerase 1 μl Open in a separate window
Set up the cDNA synthesis reaction, following the qScript microRNA cDNA Synthesis Kit’s instructions: incubate the reaction at 42°C for 20 minutes, followed by another incubation at 85°C for 5 minutes.
Reagents Volume Poly(A) tailing reaction 10 μl microRNA cDNA reaction mix 9 μl qScript reverse transcriptase 1 μl Open in a separate window
Transfer 4 μl of the cDNA product successively to 16 μl of RNase-free water to generate 5-fold serial dilution samples and store them at −20°C.
3.6. cDNA amplification by SYBR Green qPCR
Set up the qPCR reaction to amplify miR-19b as follows:
Reagents Volume 2× SYBR Green premix 5 μl 10 μM miR-19b primer 0.2 μl 10 μM Universal PCR primer 0.2 μl cDNA (from step 3 in the section 3.5) 4 μl Double distilled water 0.6 μl Open in a separate window
Set up the qPCR reaction to amplify cel-miR-39 as follows:
Reagents Volume 2× SYBR Green premix 5 μl 10 μM cel-miR-39 primer 0.2 μl 10 μM Universal PCR primer 0.2 μl cDNA (from step 3 in the section 3.5) 4 μl Double distilled water 0.6 μl Open in a separate window
Run the PCR as follows:
Pre-incubation (1 cycle): 95°C for 2 minutes
PCR (40 cycles):
Denaturation: 95°C for 5 seconds
Annealing: 60°C for 30 seconds (to collect fluorescence signals)
3.7. Data analysis
The miRNA-binding activity of Ago2 Y529E mutant was compared to that of WT by quantifying their bound miR-19b.
The threshold cycle for miR-19b co-immunoprecipitated with FLAG-Ago2 WT is normalized to the spiked cel-miR-39 using the following equation:
where and are the threshold cycles for miR-19b and cel-miR-39 co-immunoprecipitated with FLAG-Ago2 WT, respectively.
The threshold cycle for miR-19b co-immunoprecipitated with FLAG-Ago2 Y529E is normalized to the spiked cel-miR-39 using the following equation:
where and are the threshold cycles for miR-19b and cel-miR-39 co-immunoprecipitated with FLAG-Ago2 Y529E, respectively (Note 3).
The relative amount of miR-19b co-immunoprecipitated with FLAG-Ago2 Y529E to that with FLAG-Ago2 WT is given by
where and are the normalized initial amounts of miR-19b co-immunoprecipitated with FLAG-Ago2 WT and Y529E mutant, respectively, and [27].
is shown in bar graph with two-sided Student’s t-test values calculated (Figure 4a). The relative amount of miR-19 co-immunoprecipitated with MBP to that with FLAG-Ago2 WT (i.e. ) is calculated in the same way.
Open in a separate windowFigure 4.
The amount of miR-19b bound to FLAG-Ago2 WT relative to Y529E
Relative quantification of the bound miR-19b in FLAG-Ago2 WT and Y529E. FLAG-Ago2 Y529E bound less amount of miR-19b than FLAG-Ago2 WT (p < 0.05), which is consistent with the previous report [12]. Experiments were conducted three times.
4. Notes
It is important to use RNase-free materials in the step 3.4, 3.5 and 3.6.
This method is applicable for detecting any miRNAs by changing the specific miRNA primers.
Alternative exogenous miRNAs, which are not expressed in the sample, can be spiked in the sample as the reference genes. The level of exogenous spiked miRNAs should be in the linear range of Ct value of the miRNA of interest.
A list of pre-designed primers to detect miRNAs has been validated and published on the website of the manufacturer (http://www.quantabio.com/products/microrna-profiling). For miRNAs without pre-validated primers, a guide note for primer design has also been published (http://www.quantabio.com/products/microrna-profiling).
Acknowledgements
We thank G. Singh for providing HEK293T cells and reagents for us. This work was supported by the PRESTO from the Japan Science and Technology (JST) Agency (JPMJPR13L7), The Ohio State University Start-up Fund and The Ohio State University Center for RNA Biology Seed Grant to K.N.
References
1. Ha M, Kim VN (2014) Regulation of microRNA biogenesis. Nature reviews Molecular cell biology15 (8):509–524. doi: 10.1038/nrm3838 [PubMed] [CrossRef] [Google Scholar]
2. Chong MM, Zhang G, Cheloufi S, Neubert TA, Hannon GJ, Littman DR (2010) Canonical and alternate functions of the microRNA biogenesis machinery. Genes & development24 (17):1951–1960. doi: 10.1101/gad.1953310 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
3. Meister G (2013) Argonaute proteins: functional insights and emerging roles. Nat Rev Genet14 (7):447–459. doi: 10.1038/nrg3462 [PubMed] [CrossRef] [Google Scholar]
4. Nakanishi K (2016) Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins?Wiley Interdiscip Rev RNA7 (5):637–660. doi: 10.1002/wrna.1356 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
5. Kawamata T, Tomari Y (2010) Making RISC. Trends Biochem Sci35 (7):368–376. doi: 10.1016/j.tibs.2010.03.009 [PubMed] [CrossRef] [Google Scholar]
6. Peters L, Meister G (2007) Argonaute proteins: mediators of RNA silencing. Mol Cell26 (5):611–623. doi: 10.1016/j.molcel.2007.05.001 [PubMed] [CrossRef] [Google Scholar]
7. Meister G, Landthaler M, Peters L, Chen PY, Urlaub H, Luhrmann R, Tuschl T (2005) Identification of novel argonaute-associated proteins. Current biology : CB15 (23):2149–2155. doi: 10.1016/j.cub.2005.10.048 [PubMed] [CrossRef] [Google Scholar]
8. Hauptmann J, Kater L, Loffler P, Merkl R, Meister G (2014) Generation of catalytic human Ago4 identifies structural elements important for RNA cleavage. RNA20 (10):1532–1538. doi: 10.1261/rna.045203.114 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
9. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T (2004) Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Mol Cell15 (2):185–197. doi: 10.1016/j.molcel.2004.07.007 [PubMed] [CrossRef] [Google Scholar]
10. Iwasaki S, Sasaki HM, Sakaguchi Y, Suzuki T, Tadakuma H, Tomari Y (2015) Defining fundamental steps in the assembly of the Drosophila RNAi enzyme complex. Nature521 (7553):533–536. doi: 10.1038/nature14254 [PubMed] [CrossRef] [Google Scholar]
11. Gu S, Jin L, Huang Y, Zhang F, Kay MA (2012) Slicing-independent RISC activation requires the argonaute PAZ domain. Curr Biol22 (16):1536–1542. doi: 10.1016/j.cub.2012.06.040 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
12. Rudel S, Wang Y, Lenobel R, Korner R, Hsiao HH, Urlaub H, Patel D, Meister G (2011) Phosphorylation of human Argonaute proteins affects small RNA binding. Nucleic Acids Res39 (6):2330–2343. doi: 10.1093/nar/gkq1032 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
13. Lee RC, Ambros V (2001) An extensive class of small RNAs in Caenorhabditis elegans. Science294 (5543):862–864. doi: 10.1126/science.1065329 [PubMed] [CrossRef] [Google Scholar]
14. Damm K, Bach S, Muller KM, Klug G, Burenina OY, Kubareva EA, Grunweller A, Hartmann RK (2015) Improved Northern blot detection of small RNAs using EDC crosslinking and DNA/LNA probes. Methods in molecular biology1296:41–51. doi: 10.1007/978-1-4939-2547-6_5 [PubMed] [CrossRef] [Google Scholar]
15. Beckmann BM, Grunweller A, Weber MH, Hartmann RK (2010) Northern blot detection of endogenous small RNAs (approximately14 nt) in bacterial total RNA extracts. Nucleic acids research38 (14):e147. doi: 10.1093/nar/gkq437 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
16. Schmittgen TD, Lee EJ, Jiang J, Sarkar A, Yang L, Elton TS, Chen C (2008) Real-time PCR quantification of precursor and mature microRNA. Methods44 (1):31–38. doi: 10.1016/j.ymeth.2007.09.006 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
17. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, Barbisin M, Xu NL, Mahuvakar VR, Andersen MR, Lao KQ, Livak KJ, Guegler KJ (2005) Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic acids research33 (20):e179. doi: 10.1093/nar/gni178 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
18. Kozera B, Rapacz M (2013) Reference genes in real-time PCR. Journal of applied genetics54 (4):391–406. doi: 10.1007/s13353-013-0173-x [PMC free article] [PubMed] [CrossRef] [Google Scholar]
19. Beitzinger M, Meister G (2011) Experimental identification of microRNA targets by immunoprecipitation of Argonaute protein complexes. Methods in molecular biology732:153–167. doi: 10.1007/978-1-61779-083-6_12 [PubMed] [CrossRef] [Google Scholar]
20. Loedige I, Gaidatzis D, Sack R, Meister G, Filipowicz W (2013) The mammalian TRIM-NHL protein TRIM71/LIN-41 is a repressor of mRNA function. Nucleic acids research41 (1):518–532. doi: 10.1093/nar/gks1032 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
21. Hassan T, Smith SG, Gaughan K, Oglesby IK, O’Neill S, McElvaney NG, Greene CM (2013) Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique. Nucleic acids research41 (6):e71. doi: 10.1093/nar/gks1466 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
22. Shi R, Chiang VL (2005) Facile means for quantifying microRNA expression by real-time PCR. BioTechniques39 (4):519–525 [PubMed] [Google Scholar]
23. Kroh EM, Parkin RK, Mitchell PS, Tewari M (2010) Analysis of circulating microRNA biomarkers in plasma and serum using quantitative reverse transcription-PCR (qRT-PCR). Methods50 (4):298–301. doi: 10.1016/j.ymeth.2010.01.032 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
24. Yoda M, Cifuentes D, Izumi N, Sakaguchi Y, Suzuki T, Giraldez AJ, Tomari Y (2013) Poly(A)-specific ribonuclease mediates 3’-end trimming of Argonaute2-cleaved precursor microRNAs. Cell Rep5 (3):715–726. doi: 10.1016/j.celrep.2013.09.029 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
25. Landthaler M, Gaidatzis D, Rothballer A, Chen PY, Soll SJ, Dinic L, Ojo T, Hafner M, Zavolan M, Tuschl T (2008) Molecular characterization of human Argonaute-containing ribonucleoprotein complexes and their bound target mRNAs. RNA14 (12):2580–2596. doi: 10.1261/rna.1351608 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
26. Mahmood T, Yang PC (2012) Western blot: technique, theory, and trouble shooting. North American journal of medical sciences4 (9):429–434. doi: 10.4103/1947-2714.100998 [PMC free article] [PubMed] [CrossRef] [Google Scholar]
27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods25 (4):402–408. doi: 10.1006/meth.2001.1262 [PubMed] [CrossRef] [Google Scholar]
